R Programming Language Jobs

I'm looking for a freelance to support the new ML division lunch or to join the company. The concept is to use out-of-the-box tools and pre-trained models as much as possible and to create a scalable solution to be delivered to our >400 clients around the world (Luftansa, Swiss, Fiat, MobileEye, Playtica, IronSource...).

Create applications in R Implement vulnerabilities in these applications. Develop secure and insecure solutions for the vulnerable code Create training modules based on the developed code.

I need to run my R code from a website, basically, on some user submission the code executed and the return response to be displayed back on the website

Looking for someone to come in, link R shiny to our web host server! We have developed RShiny apps, and now want to create a website. If you have created a website using R Shiny you are the perfect person for this job! Thank you!

Statistical analysis is needed to be done for a secondary database, which needs descriptive statistical analysis to see the relationship between dependent and independent variables, also Chi-square tests and Logistic regression analysis. For a cross-sectional study in malnutrition.

Logistic regression report, including: - Introduction - Exploratory analysis - From initial to final model - Results - Comments about the data/analysis - Interpretation and conclusions for a lay audience

I need basic analysis on DNA Eg: ATGCCCCAACTAAATACCGCCGTATGACCCACCATAATTACCCCCATACTCCTGACACTATTTCTCGTCACCCAACTAAAAATATTAAATTCAAATTACCATCTACCCCCCTCACCAAAACCCATAAAAATAAAAAACTACAATAAACCCTGAGAACCAAAATGAACGAAAATCTATTCGCTTCATTCGCTGCCCCCACAATCCTAG

Lets discuss more detail via zoom It may help to know that the project is to reproduce one of the tabs depicted here: [login to view URL]

are you know Rshiny well? Lets discuss more detail via zoom

are you know Rshiny well? if right, it will okay. Lets discuss more detail via zoom

I have the code for the graph itself completed, but need help with the RShiny component of the work (reactives, etc.).

Looking for a SAS programmer to work on my Project

Looking for SAS programmer to guide in my new project

Looking for a SAS programmer who can guide me in my project

Writing a thesis paper, extracting datas and know a statistical software ( Stata or R).

i need someone expert in r programming with some data set in covid 19 related easy task please inbiox

Do the last four weeks of my course

The project deals with cryptocurrencies. We have to download data for at least 10 cryptos and to find the efficient portfolio in MV, following Markowitz. Sufficient constraints must also be included. We have to draw the efficient frontier, compute the weigths of the optimal portfolio, generate the price series of the portfolio retroactively and plot the portfolio series. We also have to do this in...

Hello, I have installed R into my server and I want to execute an R script into it using PHP language, The R script does this job: 1. Read three files (type of CSV ) that come from a HTML form. 2. Return a file in CSV. The R script is already runnable and functional. I want just to execute this script on my server and return the CSV file back.

I need to learn how to match data using R CEM package based on several variables. I have a sample set of scientific data with several variables (Treatment vs non-treatment group). I would like to know who to identify matches using R coarsened exact matching (CEM). Identying matching cases using CEM in R studio I would like to match people who received TXA (n=15) in this small sample with the rema...

I need help with constructing a data base using a combination of R, and Stata and Excel URGENTLY

Hi, I am looking for an expert to help in completing my research methodology and interpretation on the topic "Stock Price Movement around the Merger and Acquisition Announcements – An Event Study". Please bid your best price and timeline for completion of work. Thanks

i need someone expert in r programming with some data set in covid 19 related easy task please inbiox

i need someone expert in r programming with some data set in covid 19 related easy task please inbox

i need someone expert in r programming with some data set in covid 19 related easy task please inbox

i need someone expert in r programming with some data set in covid 19 related easy task please inbox

i need someone expert in r programming with some data set in covid 19 related easy task please inbox

i need someone expert in r programming with some data set in covid 19 related easy task please inbiox

It is debugging project. I need help to debug my code

i need someone expert in r programming with some data set in covid 19 related easy task please inbiox

I need someone to answer 3 data science related multi part questions which requires R programming. Please DM for more information. Need it in 2-3 days. The faster the better. Questions come with guidelines. Rates negotiable.

We are hiring freelancers for part-time and full time role for our organization... Interested candidate having a good knowledge in python and machine learning should only bid here.. Good Knowledge of R language is a plus

i am looking for help on R studio task i will share complete details on the chat

I have a machine learning report which needs to be modified to reduce plagiarism. I need it urgently.

I am looking for a professional with excellent mathematics skills to build a trading journal for data analysis. In a website form were customers will access on a subscription base account

We are from an IT consulting firm and an online tutoring company One of our client is in need of SAS Project Assistance which has to be completed in 2 to 3 days - on or before 10th April IST So only if you are available in these 2 days to do this kindly bid this project

Simulation of distributions Stochastic simulation Acceptance Rejection Method

I have some work that is files. Those of you who have skills on this job can bid for this project. I will select one of you and give him all the work. It is a very easy task and give me suggestion. I will share all details within only selected person.

I need someone to answer 3 data science related multi part questions which requires R programming. Please DM for more information. Need it in 2-3 days. The faster the better. Questions come with guidelines. Rates negotiable.

Assalma-o-Alaikum greetings I need R coding and Data Analysis

I'm looking for some R programming help. I have a little project and I'm stuck in a process due to my limited knowledge. This is an Inventory Management project. I've created a script: Materials in Location A (6 Stocks) are moved to Location B (5 Stocks), based on some constraints (transport tonnage capacity and material grade control). It's a LP model. I would like to: 1. Inco...

A) Summarize what the data set is ( I will send scores from 4 exams) B) Identify a problem in which a statistical test could be used and why it is important to analyze this Here are some examples of problems: Is the average score of all exams greater than 70? We want to compare performance on exams of online vs in person students We want to compare the difficulty of Exam 1 vs Exam 4. We want to...

I would like you to generate a code where one can put all the needed information in the preamble of the code (notably the instruments, the time period, the source, etc) and generate an automatic one-page PDF report for each instrument in the list with the best performance measures and charts. It deals with performance analysis. Your code needs to deal with the size of the instruments' vector ...

Project on surgical procedures and outcomes

Your solutions should contain all relevant R outputs needed to justify your answers/arguments, together with appropriate discussion. Please do not include codes/plots/output which you do not discuss. You are recommended to use R Markdown to produce your solutions, if you do not wish to included codes/outputs that you do not discuss, you can suppress the codes/outputs using the echo = FALSE argumen...

Hello everyone, I will need an expert in Statistics that can do a medical interpretation on the results. I will send you the data and requirements Best

This is a requirement for a one time coaching session. I need to learn how to analyse data using ARFIMA in R Studio i.e. I need to learn the different commands to be executed, etc to get the required output. I believe that this can be done in a single session. Kindly quote a fixed price for this session. Also, to showcase your proficiency in this area, it would be great if you could forward sampl...

Need someone experienced to look over some questions and complete some tasks that will be similar layout

data analysis using R language ( R studio) of U.S. weather

Need some help answering questionnaire using R and its techniques, its very basic for an experienced coder and user of R