Biotechnology Jobs

Biotechnology is an area of science that encompasses biological systems and living organisms in order to make or modify products or processes. Various processes related to biotechnology such as research and development, documentation, etc. can be outsourced to freelancers. Expert freelancers with biotechnology knowledge and qualifications are available to bid on projects. To get started, post your job today. Hire Biotechnology Experts

Filter

My recent searches
Filter by:
Budget
to
to
to
Type
Skills
Languages
    Job State
    10 jobs found, pricing in GBP
    Biology project needed 6 days left
    VERIFIED

    please contact me if you are a biology expert

    £15 (Avg Bid)
    £15 Avg Bid
    21 bids
    pharm chemistry 5 days left
    VERIFIED

    Hi there .. i am looking for some help with my pharm chemistry .. please bid if you can help me

    £7 - £22
    Sealed
    £7 - £22
    11 bids
    Biochemistry Expert Needed 5 days left
    VERIFIED

    Biochemistry Expert Needed for Urgent work

    £12 (Avg Bid)
    £12 Avg Bid
    7 bids
    Biotechnological Tutor 5 days left
    VERIFIED

    I need online personal tution.

    £35 (Avg Bid)
    £35 Avg Bid
    10 bids

    Online tutor need to learn Chemistry i can send the study material so you can check it and then let me know if you can help.

    £27 (Avg Bid)
    £27 Avg Bid
    18 bids

    Hello I need an expert in Organic Chemistry urgently Please apply if you have the right expertise.

    £52 (Avg Bid)
    £52 Avg Bid
    17 bids

    Using the BLAT tool on Ensembl and NCBI BLAST/ RARA protein sequencing

    £146 (Avg Bid)
    £146 Avg Bid
    9 bids

    it's a project's review paper which has to be written. The material will be provided by me.

    £12 (Avg Bid)
    £12 Avg Bid
    9 bids

    I need basic analysis on DNA Eg: ATGCCCCAACTAAATACCGCCGTATGACCCACCATAATTACCCCCATACTCCTGACACTATTTCTCGTCACCCAACTAAAAATATTAAATTCAAATTACCATCTACCCCCCTCACCAAAACCCATAAAAATAAAAAACTACAATAAACCCTGAGAACCAAAATGAACGAAAATCTATTCGCTTCATTCGCTGCCCCCACAATCCTAG

    £4 / hr (Avg Bid)
    £4 / hr Avg Bid
    5 bids
    Help with chemistry 15 hours left

    I need help solving 2 organic chemistry questions for today!

    £5 / hr (Avg Bid)
    £5 / hr Avg Bid
    22 bids